EST details — SGN-C28830

Search information 
Request: 28830Match: SGN-C28830
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28830Clone name: cLEF-49-F4
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177002 is on microarray TOM1: SGN-S1-1-1.3.8.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248946Length: 489 bp (1055 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248946 [] (trimmed) CGAGGATGGATCAGGTGCAAAACCTGGGACTAAACCGTCGACCTGTAATACTTGTGGTGGGCAAGGGCAGGTTGTGTCCTCAGCAAGGACCCCCA
CTGGGTGTTTTCCAGCAGGTGACAACATGCCTCTTCTTGTGGGGGGACCTGGAGAGATTTCTACTCCTTGCGGCACCTGCAACGGTGATGGCCGA
GTGAGGAAGTCAAAACGCATTAGCTTGAAAGTTCCACCTGGTGTAGATTCCGGTAGCCGTTTAAGGGTTCGTTCAGAAGGTAATGCANGAAGGAG
AGGTGGACCCCCCGGAGATCTTTTTGTCATGATTGAAGTCCTCCCGGATCCAGTATTAAAACGGGATGACCACCAATATTCTCTACAATTGCAAA
GTTTCTTACATTGATGCGATATTGGGTACCACTATGAAGGTTCCTACAGTAGATGGGATGGTTGATCTAAAGATTCCGGCAGGTACCCAGCCAGG
GACAACATTGGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248946] SGN-U571123 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62454 [Download] [View] Facility Assigned ID: TMGHN26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5