EST details — SGN-C28837
| Search information |
| Request: 28837 | Match: SGN-C28837 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C28837 | Clone name: cLEF-49-G11 |
| ||
| Library Name: cLEF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: mature green
Microarray: Alias clone SGN-C177007 is on microarray TOM1: SGN-S1-1-4.3.8.10
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C177007 [TUS-25-G21] | Trace: SGN-T181589 | EST: SGN-E369727 | Direction: 3' | Facility: INRA |
| Clone: SGN-C177007 [TUS-25-G21] | Trace: SGN-T181590 | EST: SGN-E369728 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E248993 | Length: 157 bp (852 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E248993 [] (trimmed)
CGAGTCCACCTCCACCTCCACCACCAAATTCTCCACCTCCTAATTCACCACCTCCACGGCTTGCTCACTCGCCTCCACCCCCTTCACCTTACTAT
GACATGTGAACACCCTCTTCTGCCCCTTACCATCCTATTATTGCACCAAATGGGGACCCTTC
GACATGTGAACACCCTCTTCTGCCCCTTACCATCCTATTATTGCACCAAATGGGGACCCTTC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E248993] | SGN-U567459 | Tomato 200607 | Build 2 | 13 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T62501 [Download] [View] | Facility Assigned ID: TMGHK42TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.877 | Expected Error Rate: 0.0419 | Quality Trim Threshold: 14.5 |
Working
