Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-C28874

Search information 
Request: 28874Match: SGN-C28874
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28874Clone name: cLEF-49-H3
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177031 is on microarray TOM1: SGN-S1-1-4.4.8.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177031 [TUS-25-H21] Trace: SGN-T181906 EST: SGN-E368953 Direction: 3' Facility: INRA
Clone: SGN-C177031 [TUS-25-H21] Trace: SGN-T181907 EST: SGN-E368954 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249081Length: 612 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E249081 [] (trimmed) TCCGTTTATAGTACTATTTGCCTCGGTGAAATTCTCAGCTTGAGTAAGTCTTGCTTTTCATTTGTGAAGGTCAATAAAGTGGAGGATTCTATACA
ATTCATTAAAGCCAGAGAAAAGCCACTTGCAGCATATCTGTTCACAAGCAACAAGAAACTGGAGGAGGAGTTTGTCATGAATATATCAGCAGGGG
GTCTGCTTATCAATGACACCACTTTACAAGTTGCGCTTTCTACTCTTCCATTTGGAGGAGTAGGGGAAAGTGGAATGGGTTCATGTCATGGCAAA
TTTTCGTTTGATACTTTCAGCCATAAGAAGGCAGTTCTACGTCGCAGTTTTGCTGGGGATGTACCTGCAAGATATCCACCTTATACAGCTGGCAA
GGCGCGATTTCTCAAAGCCCTGTTAAATGGTGATATAATCGGGCTCATTCGTGCTTTGATTGGGTGGTAAAAGTTCCATTCAATATTTGAATCTG
GGATTTCTGGTGTGAGCCCACTACTACACTTGTAAGTAGTTGATCATCCTCTACCCTTGAGGCATAAATTACCTTCCACATTTTCAAGTCACTCC
TTTTATAAATTTCATGTATCGCTATGTTACTATATACTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249081] SGN-U579227 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62589 [Download] [View] Facility Assigned ID: TMGHM38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0138 Quality Trim Threshold: 12.5