EST details — SGN-C28876

Search information 
Request: 28876Match: SGN-C28876
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28876Clone name: cLEF-49-H5
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177033 is on microarray TOM1: SGN-S1-1-2.4.8.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177033 [TUS-25-H23] Trace: SGN-T181983 EST: SGN-E369030 Direction: 3' Facility: INRA
Clone: SGN-C177033 [TUS-25-H23] Trace: SGN-T181984 EST: SGN-E369031 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249082Length: 576 bp (906 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E249082 [] (trimmed) AAGAGAAGAAGAAGAAGCCATTGCAGAGAATTTATCGAGGAGTTAGCCGGAGAGAAAAATGTCGACATCATCAGTGAACTTGGAAGATGTTCCCT
CCGAGAGCCTCATGTCGGAGCTTCTCCGCCGCATGAGGTGTTCCTCCAAGCCGGACAAACGTCTTATTCTCATTGGCCCACCTGGATCAGGGAAA
GGAACACAATCTCCTATCATTAAAGATGAGTATTGCTTGTGTCATTTAGCCACGGGGGATATGCTGAGAGCTGCTGTTGCTGCCAAAACACCTTT
GGGCATTAAGGCGAAAGAGGCCATGGATAAGGGAGAACTTGTTTCTGATGACTTGGTTGTTGGGATCATAGACGAAGCATTAAAGAAGCCATCAT
GTCAAAAAGGATTCATTCTTGACGGGTTTCCTAGAACTGTGGTGCAAGCAGAAAAGCTTGATGTGATGCTTCAAAATCGAGGTACTAAAGTTGAT
AAGGTTCTTAATTTTGCGATTGATGATGCCATCTTGGAAGAGAGAATTACCGGACGCTGGATCCACCCAGCTAGTGGGCGGTCATACCATACAAA
ATTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249082] SGN-U564094 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62590 [Download] [View] Facility Assigned ID: TMGHM39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5