EST details — SGN-C28908

Search information 
Request: 28908Match: SGN-C28908
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28908Clone name: cLEF-49-J15
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177055 is on microarray TOM1: SGN-S1-1-4.1.8.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177055 [TUS-25-I21] Trace: SGN-T181678 EST: SGN-E369816 Direction: 3' Facility: INRA
Clone: SGN-C177055 [TUS-25-I21] Trace: SGN-T181679 EST: SGN-E369817 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248919Length: 484 bp (948 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248919 [] (trimmed) ACTTTTCCCCTGGAAAGGCAACGTTCAAACTCACAAATTACTATTCTTTCAAATGTTTTCTTCTTTCATAATCCAACTTTCGATCTCTAATCAAT
CTTTTTCTTAAGCCAAAACCAAGATCCCCAATTTTTAGGGTTCCTAATCCACCCAAAAAAGCTCAAAATCTTCAAAAAGATCCATTTCTCAGAGC
ACTGTTTATTGGATATTTTTTCTTAAATCAACTTTTTTCGAATACCCTTTTGAGTTCTGATGAAAACCCATTAATTTTCTTGGTTAGTTTGGTAG
TTTTTCAGACACCCTTTTGAGTTCTGATCAAACCCTGAAATTTGCTTGGTTAGTATTGTGGATTATTTTATTTTATATGATCGAAGATGTATAGC
AATTTCAAGGAGCAAGCAATTGAGTACGTAAGGCAAGCAGTGCAAGAGGACAATAGTGGAAACTATGCAAAGGCATTTCCGTTGTATATGAATGC
ATTGGAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248919] SGN-U573760 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62427 [Download] [View] Facility Assigned ID: TMGHM56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0113 Quality Trim Threshold: 14.5