EST details — SGN-C28930

Search information 
Request: 28930Match: SGN-C28930
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28930Clone name: cLEF-49-K17
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177069 is on microarray TOM1: SGN-S1-1-6.2.8.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177069 [TUS-25-J11] Trace: SGN-T181988 EST: SGN-E369035 Direction: 3' Facility: INRA
Clone: SGN-C177069 [TUS-25-J11] Trace: SGN-T181989 EST: SGN-E369036 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249006Length: 607 bp (855 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E249006 [] (trimmed) TTTTGATCATAATGTGACGAATCGAATTTTTACTAGCAAGAATAAAATAATAATTCAGACAGTCTATCAAACTAAACTATAAAAACTTTTCGATA
TGTAACATTATGACATGACATATTACAATAAATTTCTTACAATGGCTCTACCAACATCAGAAAGTTCATGAACATCTATATTTAATTTAGAAAGT
GGTGAATATTTAATAGTTGTAGCTTTAAAATATTCTTCACATTCTTGTGCATCACCAGAAGAACCAACCATTCCATCTTCTGCAAATTTTGGATC
ACCTTTTGTTAATGCTTCTATTGCTTCTGGCATACTTGCTGTTAAAATTACCTTATACGAAAAGGCACAATTCTTCAAAGGATCTTTCCAAGCTT
GAGGAGGATTAGAATGCCTAAGTTTTGAAATAGTATTAGCAGCTTGATTAGCTTTAGATTTAATAGCATCAACCATAATTAATGCTAATGTTGTA
ATATCTCCTGCTTTTTCACTTCTTTTGTCTAAAGACAAAGTTTTCACACACAAATTATAATTTGGTGTGTTCTTGCATGTTGTCTCTACTAGATT
ATTATTCCCACTTGTTACTAGCAACATAGCAAGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249006] SGN-U579697 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62514 [Download] [View] Facility Assigned ID: TMGHK69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0135 Quality Trim Threshold: 12.5