EST details — SGN-C29001

Search information 
Request: 29001Match: SGN-C29001
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C29001Clone name: cLEF-49-N24
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177108 is on microarray TOM1: SGN-S1-1-7.4.8.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177108 [TUS-25-L2] Trace: SGN-T182068 EST: SGN-E369579 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248975Length: 449 bp (1057 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248975 [] (trimmed) GTTAGTTTTTGCATTTTCCGGTCTTCTCCTGCACTGTTCCGTCTCTTTTTTTCTCCGCAAATTCATATACTGAAGCAATCTTCAAGAATCATTTT
TCTTCAAAAACCCAAATTTCTCAAACTGAAGAAAAGGAAGAGAAACGAAGCAGTAGTAGAGAAGATGGGGGTTGATTATTACAAAGTATTGGGTG
TTGATAAGAACGCTACAGATGATGATTTGAAGAAAGCTTATAGAAAACTTGCCATGAAATGGCATCCGGATAAGAACCCACAAAACAAAAAAGAA
GCTGAAGCTAAGTTCAAACAGATCTCTGAAGCGTATGATGTGCTTAGCGACTCCCAGAAAAAAGCTGTGTATGACCAGTATGGTGAAGAAGGGCT
CAAGGGCGGGGTACCACCACCTGGAGCTGGTGGTCCTGGTGCCGGTTCAACCTACTTTTCTACTTGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248975] SGN-U570099 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62483 [Download] [View] Facility Assigned ID: TMGHN84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5