EST details — SGN-C31128

Search information 
Request: 31128Match: SGN-C31128
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C31128Clone name: cLEG-12-D4
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C185104 is on microarray TOM1: SGN-S1-1-3.1.12.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252423Length: 484 bp (1037 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252423 [] (trimmed) GAAAAGTTCTAGAGAGAGAAAGAGAAGACAATGGCTTACTCGAAGATTATCGTTGGTGCTTTCATGTTCGCTTTGGTCGCCGGATCTGCTTTTGC
TCAAGCTCCGGGAGCTTCTCCGGTAGCTTCACCGAAACCGTCTCCGGTACCGGTAGCAAAACCTCCAACTCCTGTTGTTACCCCAGTATCTGCTC
CTTCAGTATCTCCTGCTGCAAGTTCACCTTCTGATTCTCCAGTTTCATCTCCACCAGCTCCACCAACCGTTGAGACTCCGGCTTCTGCTCCTACC
GCCGGTGGTGCTCTTGCTCCGTCCATCGGTGCTACACCAAGCGGTTCTCCAACTTCCTCTCCAAATGCTGCATCCTTGAACAGAGTCGCTGTTGC
TGGATCTGCCGTCGTAGCTATCTTCGCTGCGTCTTTGCTGTTTTAGATCTGAGGAGATATTTGCATTTGGATTTGCTGGAGAGAGGGATGTTTAT
GATTTTAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252423] SGN-U581381 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66233 [Download] [View] Facility Assigned ID: TBFBV14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0071 Quality Trim Threshold: 12.5