Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C31633

Search information 
Request: 31633Match: SGN-C31633
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C31633Clone name: cLEG-14-L12
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183386 is on microarray TOM1: SGN-S1-1-1.1.1.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183386 [TUS-42-A16] Trace: SGN-T196002 EST: SGN-E394676 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E251878Length: 533 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E251878 [] (trimmed) AGCAACAAATAATACTCAAGCCTATCTTTGGGACGTTAAAATTTCAAAAGAATCACCAATAAACAAACATATTACAAAGTGCCCTCCAACTTCAG
CTTTCCATTTCCTTGAGCTCATTTTTATGAACCACAACAAGCTGATTTCTGGGAAGTTTGACTACCTCCAGCTCCTGCTTCTGGTTGATTAATCT
TGAGTGTTGACGGCTCGGCCTTGGAGTCTGTGTCTGCAAGCCTTTGTTTTATATCTCTTGCTATTGAGAAGAAAACTTGTTCCACGTTAAGATTT
GTCTTTGCACTAGTTTCAAAAAACTTAATTCCGTACTCATCTGCAAGTGCTTGACCCTTTGCTGTAGGGACAGCCCTCTTGCTTTCATCCATGTC
GGCCTTGTTCCCTACAAGTATTTTGTTAACATTGTCTGAGGCATGCTGCTCAATGTTACGAATCCAGTTCCTGATGTTGTTAAAGGAGGATTCAT
CAGTTACATCATACACCAACAGTATACCCATGGCTCCACGATAGTAAGCAGTAGTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E251878] SGN-U578498 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66535 [Download] [View] Facility Assigned ID: TBFCD66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5