EST details — SGN-C32477

Search information 
Request: 32477Match: SGN-C32477
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C32477Clone name: cLEG-1-O3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183463 is on microarray TOM1: SGN-S1-1-4.4.1.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183463 [TUS-42-D21] Trace: SGN-T200345 EST: SGN-E399356 Direction: 3' Facility: INRA
Clone: SGN-C183463 [TUS-42-D21] Trace: SGN-T200346 EST: SGN-E399357 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248385Length: 598 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248385 [] (trimmed) TCAGATCAGCTGCTTACTCCAACTGCGCGCGCAAACCATCCTGATATTCCCTAAACTTCCTTCCTTAAAGCGTCAATAGACGCAACCAAAAAAAA
AAAACAAAAAAATAATTTCTGCTTTCAGTTTCTTCTTTTGTAAAACCCTCACTCCTTTTCTTCCTTCTTTTACTACTTCCTGCTTTTGCACTCAT
TGCTTTGAACATTTTCCGCTTTAACTTCCTTTGCTGTTGTGAACTTTTTCATAATGGAAATGGACTTGCCAGTTTCTGCCATTGGTTTTGAAGGT
TTCGAAAAGAGGCTCGAAATTTCTTTCGTCGAGCCTGGTCTGTTTGCTGATCCTAATGGAAAAGGACTTCGATCTCTCACAAAGGCACAGTTGGA
TGAAATTCTCGGACCTGCTGAGTGCACCATTGTTGATAACCTGTCAAATGACTATGTTGATTCCTATGTGCTGTCCGAGTCGAGCCTCTTCGTTT
ATTCTTACAAGATAATCATCAAAACATGTGGTACCACAAAGCTGCTTCTTGCAATTCCGCCCATTCTGAGGTTGGCTGAGACCTTGTCTCTCAAA
GTACAAGACGTGAGGTATACCCGTGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248385] SGN-U580064 Tomato 200607 Build 2 541 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64448 [Download] [View] Facility Assigned ID: TBFAA86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5