Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C32478

Search information 
Request: 32478Match: SGN-C32478
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C32478Clone name: cLEG-1-O5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183465 is on microarray TOM1: SGN-S1-1-2.4.1.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248386Length: 527 bp (875 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248386 [] (trimmed) GCACATACTTTATAAATTATATTACATTGCTTAGAAACGTGAAAGTATTTAACTCAAACATTTGCTTCAAATTCAAAGGTACAATCTGCAGAAGT
ATAAATAGTAATAATAGATAACATTATTATTCTTATTCTTAGATCTTGTAACGGGACAATGCAGAAGTTCCATCTAGGCCTCTGTTATGGAGGTA
ACTAGTGTGGTCTTTCACTGTGGTTGCGCGATATTTTGGAGGATTATCTTCTGATAACAATTCAGTTATCGGTCCATAAAGCTTGGAAGATTGAT
ATGGACTTTCACCGAAGAAGCACGTGATTGACATTCTTGATCCAACATTGTTTGAGATTGCTCTGTGCTCGACACTTAAGTACTTGTCATTTGAC
AAGAGCTGCAGAAAATCTCCAATATTCACCACTAGAGAACCGGGTGTAGGAGGAACATCAACCCAATGATTCTGGTGAAGAACTTGGAGCCCTCC
CATATCATCTTGTAGAAGGATCGTTACAAAACCAATATCGGTATGTTGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248386] SGN-U578448 Tomato 200607 Build 2 590 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64449 [Download] [View] Facility Assigned ID: TBFAA87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5