EST details — SGN-C329

Search information 
Request: 329Match: SGN-C329
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C329Clone name: cLEB-3-A15
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: Alias clone SGN-C185868 is on microarray TOM1: SGN-S1-1-7.1.7.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185868 [TUS-48-I2] Trace: SGN-T188340 EST: SGN-E376300 Direction: 3' Facility: INRA
Clone: SGN-C185868 [TUS-48-I2] Trace: SGN-T188341 EST: SGN-E376301 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203230Length: 458 bp (639 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203230 [] (trimmed) AGCTGCTGTTGCCACCCGCGGCAATGGCGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAGTCCACTGCTTCTTTCCCTGTTTCAAGGA
AGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAATAAGTACGAGACT
CTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCATATAAATTGACTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGAC
TGAGCACGGATTTGTGTACCGAGAGAACCATAAGTCACCAAGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTTGGGTGCA
CTGATGCAACCCAGGGCTTGGCTGACGTGCATGATGCAAAAAAGGCTTACCCTTACGCATGGGTCCGCATCATCGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203230] SGN-U578438 Tomato 200607 Build 2 819 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22976 [Download] [View] Facility Assigned ID: TSHAI08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0164 Quality Trim Threshold: 14.5