EST details — SGN-C32981

Search information 
Request: 32981Match: SGN-C32981
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C32981Clone name: cLEG-24-N16
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183105 is on microarray TOM1: SGN-S1-1-2.1.3.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183105 [TUS-41-E23] Trace: SGN-T191485 EST: SGN-E390159 Direction: 5' Facility: INRA
Clone: SGN-C183105 [TUS-41-E23] Trace: SGN-T191698 EST: SGN-E390372 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253587Length: 491 bp (911 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E253587 [] (trimmed) CAAATGAAGGAAGCACATTACTCCAAAAGGGCTCTTTTATGCCATTTGTACATTGAACTAAACTTTGAGGAAAACAAAACTACAACAACGCATGC
GCCACTACTTGTATAACTGTGCGAGATTAAGCCATACCCCGGCTGGATGCTGGGCTTATAATCTGGAACAAAGATGAGCCAAGGACAACAAAGAC
GAAGAATCCAAGCAAGATAGGGCCAACTGGATACTGGCTTCCCTTCTTTGCAGTAGTTTCAGGAACAGCTCCTCGCTTGGTAATATTTTTCTCAA
ACCTCTCCACCTTCCTATCAGCAAGACGCCTTGATGTAGTCATTTTAAAAGGAAAATGTGGTGGCCGCCGATATATGAGAACAGAAAAATTGCAG
AGAGAATTATATTTCAGCTAAAAGTTGTTCCTCCGTGATTAAAAATCTAAATAACTATAATGGCTTACACAAGTCTTACATCTTCTCCATTAGTG
TCAAATGTTAGCGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253587] SGN-U581239 Tomato 200607 Build 2 71 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67835 [Download] [View] Facility Assigned ID: TBFDR80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0128 Quality Trim Threshold: 20.5