EST details — SGN-C33258

Search information 
Request: 33258Match: SGN-C33258
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C33258Clone name: cLEG-26-B12
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C182333 is on microarray TOM1: SGN-S1-1-6.1.7.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253338Length: 269 bp (994 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E253338 [] (trimmed) AAAATTGATTGGAAAGAGACCCCACAAGCTCACGTCTTCAAAGTGGATGTTCCTGGGATAAACAAAGAGGAGGTTAAAGTTGAAGTAGAAGAAGG
AAGGATTTTACAGCTTAGCGGTGAGAGAAGCAGAGAGAAAGAAGAGAAGAACGATAAGTGGCATCGTATGGAGAGGAGCAGCGGTAAGTTTTTAA
GAAGATTCAGGTTGCCGGAGAATGCAAAAACAGGGGAAATAAAAGCAGCGATGGAGAATGGAGTGCTGACTGTGACTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253338] SGN-U579954 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68261 [Download] [View] Facility Assigned ID: TBFDZ06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0267 Quality Trim Threshold: 14.5