Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C33799

Search information 
Request: 33799Match: SGN-C33799
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C33799Clone name: cLEG-28-E24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180528 is on microarray TOM1: SGN-S1-1-3.2.19.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180528 [TUS-34-J14] Trace: SGN-T187328 EST: SGN-E375560 Direction: 3' Facility: INRA
Clone: SGN-C180528 [TUS-34-J14] Trace: SGN-T187329 EST: SGN-E375561 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253892Length: 610 bp (949 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E253892 [] (trimmed) GGATGAGTTCATTTAGCCTTAAACCCTCTCTCTTAAGTGTAGAAAAGGCATCAATAGCAAGGCCTTCAAACTCCAAATTGATAGTCAAGGCCAGT
GGGGGCAAGAAGATCACTACCGATAAACCTTATGGTATGTCCTTAGTTTTACCTTATAGTATAATATGCAAAACTCATAGAAAATAATATTTACT
TTATACTTGAAAAAAATAATGTTTTAGTTGATTGATTATGTGAATTTTCGATTTTTGGATTTAATTCTCTGTTTTGTAATACCTGATTGTGGCAT
ACATTTATTGGATTAATGACCTTCATTTTCGAGTAAGTTTTGCAATTTTTAATTATAGTAGCAAGGAAGGAAAGAGAGTTTTGAATATAAATAAT
TTTTCTCTTCTTCTAGCTGTTAAGATATTTCTAGTTAGGATGTGATCTAGAGATTAATCGACTCTGAAATAAAGTGATAATGTGGTCCACCTTAA
AAAATTCCAACTATTTGATCTTACATAAAAAAAAATAAAAAAATGTCATACTCTAGTAGTAATATACATCAACTTGGAGAGAGATTTTTGTAGTT
ATTGGATTGTTTTTCTTAATTTGTATGAATTTATTCTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253892] SGN-U580072 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68657 [Download] [View] Facility Assigned ID: TBFEF36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5