Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C34160

Search information 
Request: 34160Match: SGN-C34160
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34160Clone name: cLEG-29-P18
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C182388 is on microarray TOM1: SGN-S1-1-7.4.8.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182388 [TUS-39-H2] Trace: SGN-T191539 EST: SGN-E390213 Direction: 5' Facility: INRA
Clone: SGN-C182388 [TUS-39-H2] Trace: SGN-T197573 EST: SGN-E396247 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254602Length: 338 bp (942 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E254602 [] (trimmed) CGATTGCATTCTCCATTCTTGGAAGTGGCCATTCTTGATTTCTTGAAACCAAAGTGTTTTTGTTATATACAGGGGGTGGAGTTAGAGGGTAAGTT
ACGCATTTAGTCGTAACTTTAGTCAAACTTCGTAATAATTTAAAATTCAGAGTGGCCATTGTTGAAAGAGAGGGTGGAATTTGTAAGTCAAGAAA
CAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTTATAATCTTTTTCTACAGAAGAGAAAGTGGGTAATTTTGTT
TGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254602] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68868 [Download] [View] Facility Assigned ID: TBFEL93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0313 Quality Trim Threshold: 14.5