EST details — SGN-C34205

Search information 
Request: 34205Match: SGN-C34205
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34205Clone name: cLEG-30-C1
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183503 is on microarray TOM1: SGN-S1-1-4.2.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183503 [TUS-42-F13] Trace: SGN-T200352 EST: SGN-E399364 Direction: 5' Facility: INRA
Clone: SGN-C183503 [TUS-42-F13] Trace: SGN-T200471 EST: SGN-E399592 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255279Length: 562 bp (876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255279 [] (trimmed) AACTTGTTCCTCTCCCGCCGGCTATCCAGTTGATATAGCAAGTTTTGATTGATGGGTGTGATTGAATTATGCAACATTTCATCTATTAGCATTGT
TAGAGCAAAACCCAGTTCTTTAAACGAAGGGAATCGGAGGAGGAGAATTGCTTGTATGGCCTCTTCAGTGTCAGTGCAAGAAGAGGAGAGCCATC
AGCAGAAACAAGGTGTAAATGGGGGTTCTTTTATTCGGACCCATCTTCTTAAATTGTCCCCTTACCAACCCATTTTGCCATTTGAGGTCTTGTCC
ACTCGTCTTGGTAGAAAGCCTGAGGACATTGTGAAATTAGACGCTAACGAAAACCCCTATGGACCTCCTCCAGAGGTAAACGAAGCTTTGGGGTC
TATGAAATTTCCATACATTTATCCTGATCCTGAAAGCCGCACGCTGCGTGCAGCTCTTGCTGAAGATTCTGGCCTTGAATCTGAGTATATTCTTG
CAGGGTGCGGTGCAGATGAACTCATTGATTTGATAATGAGATGCATATTGGATCCTGGTGACAAGATTGTTGACTGCCCACCCACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255279] SGN-U574459 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69005 [Download] [View] Facility Assigned ID: TBFEM13THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5