Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C34269

Search information 
Request: 34269Match: SGN-C34269
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34269Clone name: cLEG-30-F18
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183086 is on microarray TOM1: SGN-S1-1-5.1.3.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183086 [TUS-41-E4] Trace: SGN-T196491 EST: SGN-E395165 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255411Length: 548 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E255411 [] (trimmed) GAAAATTTTATAAGTTACATGCAACATAATGGCAATTGATTATATGATCACGAGAAATAACAACATGATATCCAAAGAAGATCAAGTATCAAATA
AGTCGTTGAGTTTTAATGCATCATTGATGAAAAACGAGTCAAATATACCAAGCCAATTCATATGGCCGGACCATGAGAAGCCAAATTATGCTAGT
GTTACTAGAGAACTACAAGTTCCACTAATAGACTTAAGTGGGGTACTTTCAAATGACCCTATTGAAATCAAGAAAGCAACTAGACTTGTTAATGA
AGCATGTACAAAACATGGTTTTTTCTTAGTGGTTAACCATGGGGTTGACACAAATCTCATAAAAAATGCACATGTTTACATAGACAAGTTCTTTC
AATTGCCACTTTGTGAGAAGCAAAAAGCACAAAGAAAAGTTGGTGAACATTGTGGTTATGCTAGTAGCTTTGTTGGAAGGTTTTCATCTAAGTTG
CCTTGGAAAGAAACACTCTCGTTTCAATACTCTGATCAGAAAGGCTCATCACACATAGTTGAAGATTATTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255411] SGN-U581955 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69137 [Download] [View] Facility Assigned ID: TBFEP33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5