EST details — SGN-C34356

Search information 
Request: 34356Match: SGN-C34356
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34356Clone name: cLEG-30-K11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177231 is on microarray TOM1: SGN-S1-1-4.1.7.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255454Length: 495 bp (868 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E255454 [] (trimmed) ATAAATTATATTACATTGCTTAGAAACGTGAAAGTATTTAACTCAAACATTTGCTTCAAATTCAAAGGTACAATCTGCAGAAGTATAAATAGTAA
TAATAGATAACATTATTATTCTTATTCTTAGATCTTGTAACGGGACAATGCAGAAGTTCCATCTAGGCCTCTGTTATGGAGGTAACTAGTGTGGT
CTTTCACTGTGGTTGCGCGATATTTTGGAGGATTATCTTCTGATAACAATTCAGTTATCGGTCCATAAAGCTTGGAAGATTGATATGGACTTTCA
CCGAAGAAGCACGTGATTGACATTCTTGATCCAACATTGTTTGAGATTGCTCTGTGCTCGACACTTAAGTACTTGTCATTTGACAAGAGCTGCAA
AAAATAATTAAAAAAAAGATTTTCTGCAGAAAATCTCCAATATTCACCACTAGAGAACCGGGTGTAGGAGGAACATCAACCCAATGATTCTGGTG
AAGAACTTGGAGCCCTCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255454] SGN-U580097 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69180 [Download] [View] Facility Assigned ID: TBFEM66THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5