EST details — SGN-C3459

Search information 
Request: 3459Match: SGN-C3459
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C3459Clone name: cLEC-20-K24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C185053 is on microarray TOM1: SGN-S1-1-6.3.12.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185053 [TUS-46-G3] Trace: SGN-T198916 EST: SGN-E397590 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205988Length: 612 bp (884 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E205988 [] (trimmed) CCTTGAAATAGATTTGATTATATTTTATATTCTAAAATAAGCCGAACCAAATACTCTTTAAAGTACTCATGATCGAATAGTAAACACATGAAAAG
AAACACAAAGGATTTAGTTTTGATAGCCCATTAACTGCTCTACAACACACTAGACTTCTACAAGCAAGTAATTCAACTTCACCCTGGAAACTGTT
TACAAAAACTAACAGAAGCAAACATCTCTCTACTGAAAACAAACGAAAACGAAGCTGGTAAATCATAGTAAGACCACCCGTAATTGTGAAATTCA
TATGCCTCGTCTCTAAGCAATCAGGAAAGGCAAAACTGTTAGCATGAACGACTCATAAGTGAACGTAGCAGAGCCAGAATATGAAGTATCCTTCT
CCTTGAACTTCTCAGTTAGCCCTTTAACGGTGAGGCAGCACTCAATGAAGTTATCATATTCAATGGCTCTACTCTTTCCACCAGTTTTATCAAAC
TTGGAGACCAGCAATTCCAGGATAGAAGGTGATACAGCATATCCCAGGCTAAGTAACGCGTCCCTCAATTCAGATGAATCAATTTTTCCACTCCT
ATCCCTATCAAATCTCTCGAAAATTCCCCTCCATTCTTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205988] SGN-U572289 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27770 [Download] [View] Facility Assigned ID: TCACZ72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5