Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C34612

Search information 
Request: 34612Match: SGN-C34612
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34612Clone name: cLEG-31-I5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180733 is on microarray TOM1: SGN-S1-1-6.3.17.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180733 [TUS-35-C3] Trace: SGN-T187461 EST: SGN-E375693 Direction: 3' Facility: INRA
Clone: SGN-C180733 [TUS-35-C3] Trace: SGN-T187462 EST: SGN-E375694 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255031Length: 619 bp (969 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255031 [] (trimmed) TTTTTTTTTACAACACAACTAGAATCGGTCAATTCACACAAATTGTTAATCATTGTTACAATATTGAGTTGATTTTGAACTTTTTCCGCTCAAAT
TTGAAGAAAATCAGAACACAAAGATGGAGAAAAGATTATTTTTCAGAAAATCAGAGAAATACAATTTACTATTTAGACATTTTCAAGCTGCATAA
AGAAACAACACAACAAAATCAACAGAGAACTTGTGAACGTTCACTTCTTAATGATGTAAAATTGGACTAACCCTATACAGGGTATTTTAAACAAA
AAGTAATAATTCATATATCTTCAACTTTCATGGTGTTATTTTCAACCTCTCTTTAATCTGCCATTTCATCATCTTCGTCATCTATTTCTTCAATC
CTCATTTTCTTCACTGCTTGAGCAGCATCATTCCTTGGCCCATTAGGTAGCTGAATCAGTACATCAGATTTTTGACCAGTAGCAGCATTCACAAG
CCCTCCATTATTCTCCACCCTATATGTTAGATCTTTTCCGCCACGTCCAGCATCTATGTACACGGTCGAATTCTCATCAATCTCCTCCTTCACAA
GCATCTTTGATAACTCCGTTACAACTTTCTTCTCCAACCACCTCCTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255031] SGN-U579266 Tomato 200607 Build 2 55 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69324 [Download] [View] Facility Assigned ID: TBFEQ51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0022 Quality Trim Threshold: 20.5