EST details — SGN-C34863

Search information 
Request: 34863Match: SGN-C34863
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34863Clone name: cLEG-32-I9
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180779 is on microarray TOM1: SGN-S1-1-8.1.17.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180779 [TUS-35-E1] Trace: SGN-T187471 EST: SGN-E375703 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253721Length: 615 bp (827 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E253721 [] (trimmed) TCAATCCTTAAGGATGCTATGATACTACTCCTTCAACATATCAACCCTTGAAAAGAGAACTTCTTCTGGTGCGAAAACAAAAAAAAAAAAATTGT
TAACAAAAAAGTCTCAAGTTTTCATATTTTTAGATCCAGTATATTGAGCTCTTTCAAAAGTTTTTTTGAAGAAATAATCATCATTTTAACATAAG
GCTCCAATCCATTATGGGCCTCTCACAATATCCAACTCCAGCAGATGCAGGAGTACTCTGTGTAATTCTAGTAAACACAGCCATATCCATCTCCA
TTATCAAGGAGATACTCCGTACGATCCTTCTTGTGATTGGCATCCGTATCGCATCATGGGAAGACTATTCTATTGAAGGACCCTTGGACTCACTT
GAATGCCGTGGAAGCCCACCACAATCATACATGGAGGAGTTCAGAAGCCGAACGCCTGCATTTCGTTATGACTCGCTACGTATCTCTAACCACCC
TGAACAAGAATGCTCTGTGTGCCTGACAAAATTTGAGCCTGATGCAGGGGTAAACAGCCTCTCATGTGGTCATGTTTTCCATAAGCTGTGTCTAG
AGAAGTGGCTCANGTATTGGCATGTAACTTGTCCTCTTTGTAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253721] SGN-U574794 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69697 [Download] [View] Facility Assigned ID: TBFEU53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0140 Quality Trim Threshold: 20.5