EST details — SGN-C37346

Search information 
Request: 37346Match: SGN-C37346
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37346Clone name: cLEG-41-M20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C185212 is on microarray TOM1: SGN-S1-1-7.1.11.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185212 [TUS-46-M18] Trace: SGN-T196593 EST: SGN-E395267 Direction: 5' Facility: INRA
Clone: SGN-C185212 [TUS-46-M18] Trace: SGN-T199073 EST: SGN-E397747 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258910Length: 404 bp (971 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E258910 [] (trimmed) TTTTTTTTTACTTGCAATGAGAAATGTGCTTTCAAATATAATCAAAGATGATAAGTCGTGCTTGTTCAGCTGTATTTACAGAGCACCAATTTACA
AACATTACGTGAATCCTGATAATCAATAATAGTAGACTTCAGTAATAACAGGATCAAATTGCAATTTACAAATAGGACATGAAATGACACTGATA
ACAGCAATTATTATTATTACCAGCATCAAAGTGAGAAACCGCACAGTCCATGGCGTTTTACGCACTAAAGCCCCTGTGGAGGGAACTCCAAATAT
TGGAAGGGATGCTAGGACAAGCTTGTGCTGATGCCTCCACCATCTGCTCCATCTGAATTCCAGCATTGCAGATATTGGCAATGGAACGCATGTGT
TTCATTCCATATTGGGATAACGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258910] SGN-U579062 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71942 [Download] [View] Facility Assigned ID: TBFGF82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5