EST details — SGN-C37445

Search information 
Request: 37445Match: SGN-C37445
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37445Clone name: cLEG-42-B16
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180696 is on microarray TOM1: SGN-S1-1-3.1.17.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180696 [TUS-35-A14] Trace: SGN-T193597 EST: SGN-E392271 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259739Length: 602 bp (929 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259739 [] (trimmed) TTTCTCTGTGTGCGCATTTATCTGTATACATTATTCGGCATTTGCAGGTCGGAGAATCTGATCGGAGCAAGTTGTGATCGACGATCGGAGTTGAA
AGGCTTGTAGTTGTTAAATTCATCCATAAGGCTAAATGGGAGACATAGTGATTGAACATTCAGGGTCGCCACATTATGAGGCCTTGAACTTGCAA
AATGTTACAACATCTGAGAATGATGCTGATCTGGTTCGGAGTTACTGTGGGGGCTTCTTTCCTGAGGGTAGTACACATGAAGAAAAATCCACTTG
CACCGAAGCCCTCGACAGAGGATTCTTTGAATATGGATGTTCCCACTATCGCCGTAGATGTCGCATTAGAGCCCCATGCTGCGATGAGATGTTTG
ACTGCAGGCATTGTCATAATGAATCTAAGAACAATATCAACATTGACCAGAAACTTCGACATGAGATTCCTCGTCACAAGGTGGAAAGGATTATA
TGCTCACTTTGTAATACAGAGCAAGAGGTTCGGCAAGTTTGCATCAATTGCGGTGTGTGCATGGGGAGATATTTCTGTGAAACGTGTAAGCTATT
TGATGATGATATATCCAAAAGACAGTATCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259739] SGN-U578661 Tomato 200607 Build 2 77 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72500 [Download] [View] Facility Assigned ID: TBFGL08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5