EST details — SGN-C37472

Search information 
Request: 37472Match: SGN-C37472
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37472Clone name: cLEG-42-C24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177452 is on microarray TOM1: SGN-S1-1-7.2.6.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259650Length: 589 bp (944 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E259650 [] (trimmed) GGCTGGTGATAATGTGGGATTGTTGTTGAGAGGTATTCAGAAGATTGATATTCAGAGAGGAATGGTGTTGGCGAAACCGGGAACAATCACTCCTC
ACACCAAGTTTGAAGCTCTTGTGTATGTTCTGAAAAAGGAGGAGGGTGGCAGGCATTCCCCATTCTTTTCGGGGTATAGGCCTCAGTTTTACATG
AGGACCACCGATGTAACTGGGAAGGTTACTTCCATTACCACTGACAAAGGGGATGAATCTAATATGGTCATGCCTGGTGATCGTGTGAACTTGGT
GGTTGAGCTCATTATGCCTGTCGCTTGTGAACAAGGGATGAGATTTGCCATCATGGAAGGAGGAAAGACTGTTGGAGCTGGTGTCATTCAGAAAA
TTCTTGAGTGATCAACGAGCAGCAGCGCATTTCCATTCAAAATGGTCCGGTCCTTGTCATGCAATATTTTTAATCCCTTGTCATATATGCAACGT
ATTGGTTACTTCTTTTCTTTTAGATCATAGGTTAGTTGGAGAAATCTTGTTATAAGTCAATGCTAGTGCACCTTTGCGAGTTTGCTTCAATTTTT
GTTTGTTTGTTTGAAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259650] SGN-U578104 Tomato 200607 Build 2 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72411 [Download] [View] Facility Assigned ID: TBFGJ24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5