EST details — SGN-C37490

Search information 
Request: 37490Match: SGN-C37490
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37490Clone name: cLEG-42-D3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177463 is on microarray TOM1: SGN-S1-1-4.2.6.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177463 [TUS-26-J21] Trace: SGN-T182504 EST: SGN-E369890 Direction: 3' Facility: INRA
Clone: SGN-C177463 [TUS-26-J21] Trace: SGN-T182505 EST: SGN-E369891 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259697Length: 567 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259697 [] (trimmed) AAAACCTCCTTTTGGATCTGCAAAATTTTTGGGTTCTTGTAATGGGTTGATTTGTTTAACCCCTATGTCATTTAAACTTATGATATGGAACCCTG
TTACTGGAAAACACAAGGAATTTGAAGATTCATTTGTTCAATGTGCTGTAAATTGTTATATACGATATGGGTTTGGTTATGATTATGTTAATGAT
GATTATAAGGTGGTTAAGATCTTTAGTTTTCCGCGAAATGAGGGGAGATATGAGAATAAGGTGAAGGTTTATAGCTTGAAGTATGATTCTTGGAA
AATGGGTGAGGCGTTTGATAGTGGTTATGTTAATGCACAATCCGGGATGTGTTTGAATGGATATCTTCATTGGGAGGTAAGCCATTGTCGCGACT
CTGGTGATGGTGATGGTGGTGGTGGTTCTTCNGAGATAATGACATTGGATTTGTCTACGGAGACGTATGGAATAATGGCATTGCCTAATTGTGGA
AATGGGAACACTAGTTGGTCGTTGAGTGTTTTAAATGGATGTTTAGTTGCTTGTTGCAACTATCATTCNGTTAGGACGGATATGTGGGTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259697] SGN-U563593 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72458 [Download] [View] Facility Assigned ID: TBFGK14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0075 Quality Trim Threshold: 20.5