EST details — SGN-C37629

Search information 
Request: 37629Match: SGN-C37629
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37629Clone name: cLEG-42-K15
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177531 is on microarray TOM1: SGN-S1-1-8.1.6.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177531 [TUS-26-M17] Trace: SGN-T182312 EST: SGN-E368902 Direction: 3' Facility: INRA
Clone: SGN-C177531 [TUS-26-M17] Trace: SGN-T182313 EST: SGN-E368903 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259629Length: 550 bp (934 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259629 [] (trimmed) GCAGTTCCGCATGCGGGGTCTTTTTTTGGGGTTGAGTGTAGGCAAACCTTACCGGGGCCTTGGCTGGTAGAGAGGCTGTTTCCAATATACCGTCG
GCTCAGTGAAAACAAAAACACAACATTTATGAAGATATAAGCAGTAACAACAACAGGATAACTCTTAATTGTGACACAATATATTCTTATTAGCC
ATATCGTAGCACCAGACTTTGAACCGTACTCCTGAATCCTAGAATTTGTGTAATGAAGAGTCCAACCTCTAGATCAACATCTGTATCAGATGCCC
ACTTTCATAACATGAATGAGCTTAATAGAATTTTGTAAGTCTGTGAATAAAGTAGAAAACATGTATTTGTTGACTTTCTTCTCTACTTATCTAAC
CTTGCTGGGCTGAGACGCCATTTTCTATTTGACAATCTACTTTATTGTTAGTGACCTTGAACTGATACCTACTGGAGTATTGGAGGTGAAACTTG
TTCAAGCAAAATAGTTAACAAACAAGGACATCATTGGTAAATCTGATCCTTTTGCTGAGTTATATGTACGCCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259629] SGN-U585890 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72390 [Download] [View] Facility Assigned ID: TBFGI68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5