Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C37694

Search information 
Request: 37694Match: SGN-C37694
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37694Clone name: cLEG-42-N17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177565 is on microarray TOM1: SGN-S1-1-6.3.7.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177565 [TUS-26-O3] Trace: SGN-T182317 EST: SGN-E368907 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259550Length: 545 bp (961 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259550 [] (trimmed) AAAACTTAAACTCAATAAATTAGTATGCTGGGAATAAAAGATTTCATAGGAAATCTGAGAACTTTACAATCAAATCCTCTTAACATATCACACTA
CCAGACAAGAGTACATAAACAAAACCCAAGTTGCACAAAGCAAGATAAAGCACCCCACTAATTAAACCAACATTAACAAATTATTACAACGTCAT
TATCTTAGTACTAAACAATCTTTTCTTCCCATTCCCATTAATTAGTGTTGTATTAATACTGGTCTCATCAAACAGTTGCTATTGGGCCCAAGTTG
ACAGCAGTTTCCACAGCCTTCATTGCTTCAAACCTTGGCTCTTTAGCTTGGAATTTGAGACCTGCATATAATTTCATATAATCCTCAAAAACAAA
TTTGGGATACATTATTGNGTTCTCTTTTTCTTCCTTCTCCAGCAATTCTGGTGCTGGATAGATGACAGCATCACTCCCCGGATTGTAGAACGAAG
CCAAGGACATTCTGTTTCCATCAGGCTGAGCAATCACCCTGTGCTCCACACTCTTGTATTTTCCATTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259550] SGN-U577773 Tomato 200607 Build 2 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72311 [Download] [View] Facility Assigned ID: TBFGK81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5