EST details — SGN-C37701

Search information 
Request: 37701Match: SGN-C37701
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37701Clone name: cLEG-42-N24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177571 is on microarray TOM1: SGN-S1-1-8.3.6.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177571 [TUS-26-O9] Trace: SGN-T182243 EST: SGN-E368833 Direction: 3' Facility: INRA
Clone: SGN-C177571 [TUS-26-O9] Trace: SGN-T182244 EST: SGN-E368834 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259596Length: 587 bp (920 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259596 [] (trimmed) AAGTGCCGCTTATGGATACTGGAACTTTTGTTTCAACACACTTTATCACTCAACTCAGGTTATTGCTGTGCTGGTAGGAGGAATATCTATCCTGG
CTGGTCATATTACTGCAGAACAACTTACCAAATTCGTATTATACAGTGAATGGTTGATTTATTCTACATGGTGGGTAGGGGACAATTTTTCGTCA
TTGATGCAATCTATTGGGGCAAGTGAGAAGGTTTTTCAATTAATGGATCTCGGTTCTAGAGATAAATTCATTGACAAAGGAGCCAAGTTGGAAGG
ATTAGCAGGACGCATTGAATTTGTGAATATTAGTTTCTACTATCCTTCAAGAGTTGAGGTGCCAGTACTTCAACATATTAACTTTGTGGTGCATC
CCGGTGAAGTAGTAGCACTCGTTGGCCTAAGTGGTAGTGGAAAAAGCACTCTGGTGAACCTTCTCCTTCGGCTGTATGAGCCAATAAGTGGGCAG
ATATCTATTGATGGCTACCCGATTAGAGATTTGAACATCAAGTGGTTGAGGGAAAGAATTGGATATGTGGGACAGGAACCTAGACTTTTCCGCAT
GGATATCAGCTCAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259596] SGN-U566990 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72357 [Download] [View] Facility Assigned ID: TBFGL84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5