EST details — SGN-C37747

Search information 
Request: 37747Match: SGN-C37747
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C37747Clone name: cLEG-42-P7
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177591 is on microarray TOM1: SGN-S1-1-4.4.7.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259733Length: 567 bp (951 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E259733 [] (trimmed) GTAATAATGGAGACCAATGGGATTGGACGACGTCGTTTGTACTGTTTGGCTTGTTGTCTGGACTCATGTACTATGTTTTCTTGGGTGCTCCTAAC
CAGACCCCGTTGACAGACGTGTATTTCTTAAAAAAGCTCCTTAATTTGAAAGGAGATGACGGATTCCGTATGAATGAAGTGCTAGTGGGACTTTG
GTATATCATGGGTTTATGGCCATTAGTTTACAGTATGCTGCTCCTTCCTACTGCTAGAAGTTCAAAAGGCGGCATTCCTGTTTGGCCTTTTCTTG
TACTTTCATGCTTTGGTGGTGCATATGTTCTCATTCCTTATTTTGCTCTCTGGAAACCACCACCTCCACCTGTTGAAGAAACTGAGCTTCAAAGG
TTACCTTTGAATTTGCTTGAATCTAAGCTAACAGCAGGGGGCTAGGGATAATATTTTATGCAGGTTTATCGAGTGGAGATGTCTGGAAGGAATTT
TACCAATACTTCAGAGAAAGCAGATTCGTCCATGCGACGTCGATTGATTTCAGTTTACTATCGGCATTTGCACCCTTCTGGATTTACAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259733] SGN-U581072 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72494 [Download] [View] Facility Assigned ID: TBFGK88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0063 Quality Trim Threshold: 20.5