EST details — SGN-C39620

Search information 
Request: 39620Match: SGN-C39620
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C39620Clone name: cLEG-4-P13
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C182449 is on microarray TOM1: SGN-S1-1-2.2.8.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250124Length: 431 bp (571 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E250124 [] (trimmed) AAAATCATAACAAAACTGATATAAAGGTTTCAACTCAGTATCCAAGGAGCACAACTAAACAAAAAATGCAATAGTATCTATAACGCGTACAAGTC
AAAACGCCTGAAACTGCAAAGATTGTAATACAATGTCCTTAGAAGATGCGTTGAGTCTTTCCCATGGTACTCTTCAAGTACAAGCATCTCACATT
TTGCCAATTCTTCTTTAGCAAGGACACGAGAAAGTTGACACTCATCTGCACGTTCTGGAAGATTTGTTTCTCCTCCATATCCATATTACCTACGG
CAACTCCCATGCAAAGAACCTTCTTCAACTGGAATTTGATAGTCGCCTTGGTCTCGTTTACCTTAGACTCGAGTGATTCCTGGTGGGAAACAAGG
GTAGGAAACTTACCTGCCTTGTTCAAACCAGGCCCCAAGAGACGGGGGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250124] SGN-U578592 Tomato 200607 Build 2 55 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64738 [Download] [View] Facility Assigned ID: TBFAO91THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5