EST details — SGN-C409

Search information 
Request: 409Match: SGN-C409
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C409Clone name: cLEB-3-F20
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: Alias clone SGN-C185871 is on microarray TOM1: SGN-S1-1-4.1.7.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C409 [cLEB-3-F20] Trace: SGN-T22913 EST: SGN-E203167 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203166Length: 396 bp (654 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203166 [] (trimmed) GAAAATGGCAGCAACAGGTAGCTCAGCCACAGTTGTTAGAGCAACTCCATTTTTGGGCCAGACCAAATATGCTAACCCCCTAAGGGATATAGTTC
CTATGGGCTCTGCCAGATTCACCATGAGTAATGATTTGTGGTATGGACCTGACCGTGTCAAGTACTTGGGACCATTTTCTGCTCAAACTCCTTCA
TACTTGACTGGAGAATTCCCTGGTGATTACGGATGGGATACTGCTGGTTTATCTGCTGATCCCGAGGCCTTTGCTAAGAACAGAGCTCTTGAGGT
TATCCATGGGAGATGGGCCATGCTTGGAGCTTTTGGTTGCATTACACCAGAAGTTCTTGAAAAATGGGTAAAAGTGGACTTCAAAGAACCAGTAT
GGTTCAAAGCTGGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203166] SGN-U579843 Tomato 200607 Build 2 157 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22912 [Download] [View] Facility Assigned ID: TSHAL34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5