EST details — SGN-C4408

Search information 
Request: 4408Match: SGN-C4408
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C4408Clone name: cLEC-25-H1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181987 is on microarray TOM1: SGN-S1-1-8.3.10.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181987 [TUS-38-G9] Trace: SGN-T194527 EST: SGN-E393201 Direction: 3' Facility: INRA
Clone: SGN-C181987 [TUS-38-G9] Trace: SGN-T194528 EST: SGN-E393202 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205255Length: 663 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205255 [] (trimmed) GTTCCGACAATTGACTTGTCGGATGACAAGTCTATTGCGTCCGAAATGATTGTGAAAGCATGTGAAGATTACGGTTTCTTTAAAGTTATAAATCA
CGGGGTTTCGAAGAAGGTGATCGCGAGAATGGAAAGGGAAGCCGCGGACTTCTTTTCGCGTCCCGTCTCTGAGAAGGGACGCGCTGGTCCCGCGG
CTCCCTTTGGTTATGGTAGCAAGAACATTGGCTTCAATGGAGATAAAGGTGATCTTGAATATATTCTCTTGGAAGCAAATACACTTTCTCTTTCT
CAACGAGCCAAAAACTTCTCTAATGACCCTTCTACTTTCAGCTCGGTGACAAATGATTACGTAAGTGCAGTTAGGAAGCTATCTTGTGATATTCT
TGAATTGGTGGCTGAAGGTTTATGGATAGAAGACAATTCAATTTTCAGCAAGCTCATAAGTGATTCACACAATGACTCTTGTTTCAGAGTCAATC
ACTATCCACCATTTATCACACCTAATAATGATGATAATCAAGATGAACTAAACAATATTCATTGGGGCCTATCACCAAATCCATCAAAATCAAGA
GTTGGATTTGGAGAACATACTGATCCACAAATGCTAACAATCCTTCGATCAAATGACGTTAGTGGACTTCAAATATATACTCATGATGGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205255] SGN-U568917 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28671 [Download] [View] Facility Assigned ID: TCADU37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5