EST details — SGN-C46600

Search information 
Request: 46600Match: SGN-C46600
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C46600Clone name: cLEI-13-B2
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177601 is on microarray TOM1: SGN-S1-1-2.4.6.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177601 [TUS-26-P15] Trace: SGN-T182615 EST: SGN-E370001 Direction: 3' Facility: INRA
Clone: SGN-C177601 [TUS-26-P15] Trace: SGN-T182616 EST: SGN-E370002 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268429Length: 679 bp (872 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268429 [] (trimmed) AGAAATGGCTAATACCAAAGACTCATACCACATAATTACAATGGATACCAAAGAGTCTTCAATTCCAAGTCTTCCTATGAAAGAAATTCCTGGTG
ATTATGGTGTCCCATTCTTCGGGGCGATAAAAGATCGTTACGATTTTCATTACAATCAAGGTGCTGATGAATTTTTCAGGTCTCGCATGAAAAAG
TACGATTCCACTGTCTTTAGAACCAATGTCCCTCCTGGTCCTTTCAATGCTCGTAACTCTAAAGTTGTTGTCCTTGTAGACGCGGTTAGTTATCC
CATCCTTTTCGATAACTCCCAAGTCGACAAGGAAAACTACTTTGAAGGTACTTTTATGTCCTCTCCATCTTTCAATGGTGGTTATAAGGTTTGTG
GTTTTCTTGGTACTAGTGACCCTAAACACACCACTCTAAAAGGTCTTTTCTTGTCCACACTAACTAGATTGCATGACAAGTTCATCCCTATCTTT
ACTACATCAATCACTTCAATGTTTACCAGTCTTGAAAAAGAACTGTCTGAGAAAGGAACGTCTTACTTCAATCCCATCGGTGACAACTTGTCATT
CGAATTCCTCTTTCGATTGTTTTGTGAAGGGAAAAATCCAATTGATACAAGTGTTGGCCCTAATGGACCAAAAATTGTAGACAAATGGGTTTTTC
TTCAACTAGCTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268429] SGN-U566889 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82490 [Download] [View] Facility Assigned ID: TGSBZ01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5