EST details — SGN-C46630

Search information 
Request: 46630Match: SGN-C46630
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C46630Clone name: cLEI-13-C8
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177613 is on microarray TOM1: SGN-S1-1-6.1.6.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177613 [TUS-27-A3] Trace: SGN-T182831 EST: SGN-E371323 Direction: 3' Facility: INRA
Clone: SGN-C177613 [TUS-27-A3] Trace: SGN-T182832 EST: SGN-E371324 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268518Length: 558 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268518 [] (trimmed) AAAGGGCAAAAATGGGAATTTGGGACTTCATAAGCTCCGGCGCAGAATCGGTGAAACGGAACACACCGGATCTAGCAACTCCGGTGACGAAGGTA
TGCAAAGGTACCTATTATTACAGTGCGACCGCCGTTAAAATGATCGACAACGTCGTTCGAGTTAGCGGCGTGCAGAAGCTGGGTCAGTACAGTTA
CATGCCTGATGAAGAAGGCAGGGCTAAAATCGTCAGTTTCAGTACAAAATTCGCCAAAAATGCTTCTGTTTATGCAATCAAAGAATCAGCCAAGA
TCTTCCTTGCTGGTGGAAAAGCAGTCTCCCAAATTTACTCTCAAACAGTTCGGGAAATGGAAGTCGAGTCTAAAAATAATCAGAACGCATCATGC
AACAAGGAAATAACTAGCAATTCGAGTAAGGTTGCCACTAGTACTGGTCCTCTGGGATTGCTCAATGGGGCAGAGATGCTGGAAAACAGAGAACT
GCAGTTAAGTTCTGAAAATAAAGCTCAGGTTGATTCATTTGCTCATCAAACACCTGAAGATGTTCTACGAGTTTTCATGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268518] SGN-U574977 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82579 [Download] [View] Facility Assigned ID: TGSBX16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5