EST details — SGN-C46709

Search information 
Request: 46709Match: SGN-C46709
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C46709Clone name: cLEI-13-H13
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177625 is on microarray TOM1: SGN-S1-1-2.1.6.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177625 [TUS-27-A15] Trace: SGN-T182837 EST: SGN-E371329 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268408Length: 490 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E268408 [] (trimmed) GTAAGACGAGACCCGTATGAAGTGTTGGCTGTGACGAGGGATGTCGTCGGATCAGGAGATTAAGACTGCTTATAGAAAGCTTGCTCTCAAGTATC
ATCCTGACAAGAATGCTAACAATCCTGAAGCTTCAGAACATTTCAAGGAGGTTGCATACTCATATAGCATTCTATCTGATCCAGAGAAAAGGAGG
CAATATGATATGGCTGGCTTCGAGGCTCTTGAAGCTGAAGGAATGGATATGGAAATTGATTTGTCCAACCTCGGAACTGTCAACACAATGTTTGC
AGCATTGTTTAGCAAGTTGGGTGTTCCTATCAAAACAACTATCTCTGCGAATGTTCTTGAAGAAGCTTTGAATGGAACTGTCACGGTCCGCCCTC
TTCCAATTGGTACATCAGTCAGTGGAAAGGTAGAAAAGCAAAATGCTCATTTTTTCGGTGTAACAATTAGTGACGAACAAGCAGAAGCAGGGATT
GTAGTAAGAGCTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268408] SGN-U574490 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82469 [Download] [View] Facility Assigned ID: TGSBY43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5