EST details — SGN-C47440

Search information 
Request: 47440Match: SGN-C47440
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C47440Clone name: cLEI-16-E1
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177666 is on microarray TOM1: SGN-S1-1-1.3.6.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269106Length: 533 bp (851 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E269106 [] (trimmed) GGAGTTTACTTCACTATCAATGCTAACAGCGAGGTGGTGATGGGGCAGAAATTGAGCTGTGGACAGCAATCTAATGAACATGGATTGTTTATTGC
AGTCCAAAATGGTGAGGTTGAAAAAGTTGAAGCTATGGTTGATGAAAATCCAAATGTGATTAGACTGAAAACTCTTCGTGGGAAGCTTTCTGCAC
TTCATGTAGCTGCTGTTAATGGCCAGATCGAGGTTCTGTGTATGCTTTTGGATCGCGGAGTTAATCCAGACATCTTGAATCGCCACAAACAGACC
CCATTAATGTTAGCTGCTATGCATGGAAATGTGTCCTGCGTGGAGAGGCTAATTCAGCTAGGTGCTAATATTTTAATGTTTGATTCACTACATGG
AAGAACTTGTTTGCATTACGCTGCTTACCATGGCCACTCTGACTGCCTACAATCTATTCTTGCATCCGCTCATTCGGCTCCTGTTGCTCAATCTT
GGGGATTTGCGAGATTTGTGAACATAAGAGATGGAAGTGGTGCAACCCCATTGCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269106] SGN-U573178 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83330 [Download] [View] Facility Assigned ID: TGSCI25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5