EST details — SGN-C47529

Search information 
Request: 47529Match: SGN-C47529
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C47529Clone name: cLEI-16-I2
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177683 is on microarray TOM1: SGN-S1-1-8.4.6.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177683 [TUS-27-D1] Trace: SGN-T183129 EST: SGN-E370892 Direction: 3' Facility: INRA
Clone: SGN-C177683 [TUS-27-D1] Trace: SGN-T183130 EST: SGN-E370893 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269000Length: 580 bp (857 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269000 [] (trimmed) AGAGCTCCTCCAAATATCGTAAGCAAAGTATTGAGTGTTGTGACTGGTAACACTTGCAACATGAGCAACACACTTCCAGGTGCAACAGGATCTTG
TGTTCCTTGGAGAAAAACAGACCTGAAGCATTCAAGCAATGAAATTTATGTTGATTTAGTTGAAGAAATGGATGCTACTATAAATAGAGACGGGG
TTCTGGTGAAATGTGAGATCTATGGTGAAGTTCAAGTGAATTCTCATCTTTCTGGTCTTCCTGATCTTACCCTTTCATTTGCAAATACTTCCATC
CTGAATGATGTAAGATTCCATCCTTGTGTTCGACTACGACCATGGGAATCAAACCAAATTCTGTCTTTTGTTCCTCCTGATGGACAATTCAAGCT
CATGAGCTACAGAATAAAGAAGTTGAAGAGCACCCCTATATATGTAAAGCCACAAATTACTTCAGACTCAAGGACATGTCGTATTAGCTTGTTAG
TTGGGATACGCAATGATCCTGGGAAGGCAATTGATGATATAAACGTTCAATTTCAACTACCCCCTCGCGTTTTATCTGCAGATCTTACATCAAAT
TATGGAACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269000] SGN-U576835 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83224 [Download] [View] Facility Assigned ID: TGSCJ49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5