EST details — SGN-C5213

Search information 
Request: 5213Match: SGN-C5213
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C5213Clone name: cLEC-30-O9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173767 is on microarray TOM1: SGN-S1-1-4.4.18.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207152Length: 539 bp (764 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E207152 [] (trimmed) TAGGTCCGAGTACATTTGCTGTATCGTCTGCTTTAAAGGCTTGTGCAAGGATTTTGTATAGGTCTGGTGGGATATCGATTCATGCACAAGTTTTT
AAGTATGGCTTTTGTAATGTTGTTTATGTGCGGACAGCTCTAGTAGATTTTTACTCGAAAGTAGGTAATATGGATTTTGCCCGGAGCATCTTTGA
TGATGAGATGGTTGAGAAAAATATTGTATCGTGGAATTCAGTGTTAGGTGGATATGTCAAATCTGGTGACTTAACAATGGCACAAAGTGTTTTTG
ATGAGATGCCGGAGAAGGATGTTATTTCGTGGAACTCCATGGTGTCTGGGTATGCGAGGATGGGGAATATAGAGCGGGCAAATGCATTGTTTAGA
CAGATGCCGGAGAGAAGTTCTGCCTCTTGGAATGCAATGATTAGCGGATATATAGAGTGTGGGAAGATAGAGTTTGCACGCAGTTTCTTTGAGGC
AATGGACAAAAAGAATAATGTTTCATATATCATATAGATTTCTGGATACTCAAAAAATGGAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207152] SGN-U569264 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29148 [Download] [View] Facility Assigned ID: TCAEM89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5