EST details — SGN-C5214

Search information 
Request: 5214Match: SGN-C5214
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C5214Clone name: cLEC-30-P10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173771 is on microarray TOM1: SGN-S1-1-8.1.18.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173771 [TUS-17-A1] Trace: SGN-T196967 EST: SGN-E395641 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207103Length: 500 bp (785 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207103 [] (trimmed) AAATTAACTAAATAAAAAACATTTAATTACAAATTATACAAACTTCCCTAACTACACTAATTTTTTCTTAACATTTATAGCTTTGCCCCCCTTTG
ACAAGCTACCAATATAAACCACACAAATATTGAACCAAATTCCCTCCTTTTTTTGTTGGTTCTTTTTTTTTTTATTTCACAAAGCCAACAATTAT
TTTACTGTGGCATTAATTAAAACAAATAAATTAACATACACCCCTACCTTAACAAACACCCCTACCTAACCAAATCTTTATTTTTTGTACAAATA
ATTTTCTTTCTACTAAAAAATGAAAATTAATAATAAAATCGATATAACTTGAAGTCGATTGAGAAATATCAATTAGTATAGTGTTTTTGATTACT
GTTTCTCTTCTTTTCATCTTTTCATATCTGAGGTAGACGCAAACATTTTTCCCATTTCAAGAAACCTATTTGACGCACCATTTTTTGCTTAAAGG
GTTTTTTCCCGTTTGAGCCTCAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207103] SGN-U564684 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29099 [Download] [View] Facility Assigned ID: TCAEP89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.881 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5