Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C5561

Search information 
Request: 5561Match: SGN-C5561
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C5561Clone name: cLEC-32-E6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C182125 is on microarray TOM1: SGN-S1-1-6.1.10.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182125 [TUS-38-M3] Trace: SGN-T194545 EST: SGN-E393219 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207747Length: 530 bp (829 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E207747 [] (trimmed) GGGATAAGAAGCCAATAAGGGTTTTCTCTTCTCAATTTCTCTCTTCTTTTTCTTCTCTACAGAGAAAGAGAGAGTTGTTCAAAGAAAATCTCTTC
TTCTTCTTCTTCATATCCCTTTTGGGGTTGAAGAAAAAAGAAGGAAAGAAACAGAGAGAGAGCGACAAAAAACCCTTTTGTATTCCAATTTTTGG
ATACATATATTACCCATCCTTCTATACATATCTTTTTAAGGGAGTTTTTTTTTTACTTTTTAACAATGGATTCGGGTTCTTCTGCTTATTTGTCA
ATGGTGGATCCTTTCTTGGTTGAAGCCCTTCAAAACCCACGTCATCGTCTTACCATTCTAAGAATGGAACTCGACATTCAGAAGTTCTTGCAAAG
TTCCGACGTGCAACAGTTTGAGTTCCCACATTTTCCGACTTCCTACCTTCGTCTTGCTGCGCACCGTGTTGCTCAACACTATGGTTTGCAGACTA
TGGTTCAGGATAATGTTGTGGATGGTCAGGGAGCCAAAATCCTGGTGACAAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207747] SGN-U583622 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29960 [Download] [View] Facility Assigned ID: TCAEV27THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5