SGN ID: SGN-C5594 | Clone name: cLEC-32-G19 |  | Order Clone |
|
Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: Alias clone
SGN-C173817 is on microarray TOM1: SGN-S1-1-2.2.17.6
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E207718 | Length: 347 bp (727 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E207718 [] (trimmed)
GCCGTGATGATAATACTTTACTAATTACTTGTTCAAAAGAAGCTGATAATCATAACTGACATAAAGTCTAAGCTGATATAGCTACTGGCCTAAAC
AAAATGCCTAAATAGATCTGTGGTGTCCAATACTTCTCAGTACAAAAAAGTACAACAGAAGATTAACCAGATAATGCAATTCTCGACCTAAGGCA
AAACTCACGTGATACCAAGCCAGGCAGTATAATCACAAGCTGCAACACTAGCAAGGACTTATGCAAACGTCGCCAAAATGTTCTTCTTGAGGGTG
AACTCATCCGCCTTAGTGGGGCTGATTGACTTGGCAAGCATGCGCTCTAATCGCTGAATCTC
[BLAST] [AA Translate]
SGN-ID: SGN-T29931 [Download] [View] |
Facility Assigned ID: TCAEU46THB
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 |
Expected Error Rate: 0.0036 |
Quality Trim Threshold: 14.5 |