EST details — SGN-C5594

Search information 
Request: 5594Match: SGN-C5594
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C5594Clone name: cLEC-32-G19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173817 is on microarray TOM1: SGN-S1-1-2.2.17.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173817 [TUS-17-B23] Trace: SGN-T189122 EST: SGN-E376508 Direction: 3' Facility: INRA
Clone: SGN-C173817 [TUS-17-B23] Trace: SGN-T189123 EST: SGN-E376509 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207718Length: 347 bp (727 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207718 [] (trimmed) GCCGTGATGATAATACTTTACTAATTACTTGTTCAAAAGAAGCTGATAATCATAACTGACATAAAGTCTAAGCTGATATAGCTACTGGCCTAAAC
AAAATGCCTAAATAGATCTGTGGTGTCCAATACTTCTCAGTACAAAAAAGTACAACAGAAGATTAACCAGATAATGCAATTCTCGACCTAAGGCA
AAACTCACGTGATACCAAGCCAGGCAGTATAATCACAAGCTGCAACACTAGCAAGGACTTATGCAAACGTCGCCAAAATGTTCTTCTTGAGGGTG
AACTCATCCGCCTTAGTGGGGCTGATTGACTTGGCAAGCATGCGCTCTAATCGCTGAATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207718] SGN-U577569 Tomato 200607 Build 2 93 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29931 [Download] [View] Facility Assigned ID: TCAEU46THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5