EST details — SGN-C62007

Search information 
Request: 62007Match: SGN-C62007
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C62007Clone name: cLEM-1-C5
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177726 is on microarray TOM1: SGN-S1-1-5.1.6.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177726 [TUS-27-E20] Trace: SGN-T183007 EST: SGN-E370632 Direction: 3' Facility: INRA
Clone: SGN-C177726 [TUS-27-E20] Trace: SGN-T183008 EST: SGN-E370633 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270406Length: 455 bp (1201 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270406 [] (trimmed) ACGTGAACTTCCTGAGGCAACCATATTGCGACCAGCAGTGATGATCGGTACAGAAGATAGAATTCTGAATCCATGGGCATTCTTTGCAAAGAAAT
ATGGTTTTCTCCCTCTAATCGGAGGTGGTTCAACAAAAATTCAACCTGTATTCGTTGCTGATGTTGCTTCTGCAATTGTTTCTTCTTTGAAAGAC
AATGGCACCAGCATGGGAAAAGTTTATGAACTTGGTGGCCCAGATATTTACACTATGCATGATTTGGCAGAGCTCATGTTTGATATGATCCGTGA
ATGGCCACGCTATGTGAATGTTCCTTTCCCTATTGCTAAGGCTATTGCATCTCCTCGAGAATTTTTGCTCAACAAAGTACCAGCTCCAATGCCTG
TCCCTACAATATTTAATCTGGATGCGATTAAAGCCTTGGCCACGGACAATGTTGTGTCAAAAGATGCTTTGACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270406] SGN-U586248 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83779 [Download] [View] Facility Assigned ID: TGFAA15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0075 Quality Trim Threshold: 20.5