Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C62115

Search information 
Request: 62115Match: SGN-C62115
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C62115Clone name: cLEM-1-I15
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177768 is on microarray TOM1: SGN-S1-1-3.3.6.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177768 [TUS-27-G14] Trace: SGN-T182941 EST: SGN-E370566 Direction: 3' Facility: INRA
Clone: SGN-C177768 [TUS-27-G14] Trace: SGN-T182942 EST: SGN-E370567 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270338Length: 479 bp (1213 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270338 [] (trimmed) AGGGGCGGCTGCATCTCCATCTCCTTGTTTTTCCAAAACCCTACCTCCATCTTCATCAAAATCTTCCACCCTTCTTCCCAAATCTACCTTTACTT
TCCACAATCACCCTAAAAAAGCATCACCCCTTCACCTTACACACACCCAACATCATAGCCGTTTCACTGTTTCAAATGTCATCCTATCAACCACG
ACGCATGACGACGTTTCTGAACCCGAAATCTTTGTTTCCCGTTTCGCCCCTGACGAACCCAGAAAGGGTTGTGATGTTCTTGTGGAGGCACTTGA
AAGGGAAGGGGTTAAGGATGTGTTTGCATACCCAGGAGGTGCTTCCATGGAGATTCATCAGGCTTTGACACGTTCAAATATTATTCGTAATGTGC
TGCCACGTCATGAACAGGGTGGTGTGTTTGCTGCAGAGGGTTACGCACGGGCTACTGGGTTCCCTGGTGTTTGTATTGCTACATCTGGTCCGGGA
GCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270338] SGN-U572739 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83711 [Download] [View] Facility Assigned ID: TGFAA56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0049 Quality Trim Threshold: 20.5