Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C62154

Search information 
Request: 62154Match: SGN-C62154
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C62154Clone name: cLEM-1-K17
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177779 is on microarray TOM1: SGN-S1-1-8.4.6.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177779 [TUS-27-H1] Trace: SGN-T183149 EST: SGN-E370912 Direction: 3' Facility: INRA
Clone: SGN-C177779 [TUS-27-H1] Trace: SGN-T183150 EST: SGN-E370913 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270341Length: 406 bp (1186 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270341 [] (trimmed) AAGGCAAAGCAAGAGTTTCAGGCAATCATTAGAGATCCATTTATGCTTAATGCTGTTATCTTGGTTTTCGCTAACAAGCAGGACATGAAAGGAGC
AATGACTCCAATGGAAGTGTGTGAAGGCCTCGGTCTTTATGATCTTAAAAACCGGAAATGGCATATACAAGGTGCATGTGCTCTTAAAGGGGATG
GTCTATATGAGGGACTAGACTGGTTATCAAGCACTTTGAAAGATCTCAAGGCCGCTGGGTACTCTTCAGTGGGGACTTCTGCCTTCTGATTGATC
AGGCTTACTAAGAACCTATTTCGAGGGACAAAGCTGATTACCCTGCCGTCTGTAAATTAAAACGCCTGAACTCACATTGAACATTGTTACTTGTT
CTTTCGGGTCTGTGCTTTTAAATAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270341] SGN-U577084 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83714 [Download] [View] Facility Assigned ID: TGFAA69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5