Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C6337

Search information 
Request: 6337Match: SGN-C6337
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6337Clone name: cLEC-35-C14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173895 is on microarray TOM1: SGN-S1-1-4.2.18.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173895 [TUS-17-F5] Trace: SGN-T189132 EST: SGN-E376518 Direction: 3' Facility: INRA
Clone: SGN-C173895 [TUS-17-F5] Trace: SGN-T189133 EST: SGN-E376519 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210297Length: 566 bp (666 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210297 [] (trimmed) GAAATGTTGTCGATCTACAAGACGTGTTGCAAAGGTTCGCATTTGATAACATTTGTAAAATTGCATTTGGTTATGATCCAAAGTATTTGTTACCT
AACTTACCTGAAGCAGAATTCGCGGTAGCATTTGAAGATTGTGTTCGATTGAGCAGTGAGAGATTTGCTGTCCCTTTTCCGTTGATTTGGAAAAT
GAAACGCGCTTTTGGTATTGGTTCTGAGAAGAAATTACGAATTGCAGTTGGAGAAGTGCGTGAGTTTGCGAAGAGAATAGTGAGGGAGAAGTTGA
ATGAGAGATCGTCGTTGGATTCAGCTGATTTGTTGTCGAGATTTTTGAGTACAGGGCACTCTGATGAAGATTTCGTTGTTGATATAGTGATAAGT
TTTATTTTAGCAGGACGCGATACGACTTCAGCTGCGTTGACATGGTTTTTCTGGTTGATTTCGAAGAATGCAGATGTGGAATCTGAAATATTGAG
AGAAATTGGGGGAAAAGAAGAGGATGTTTCAATGCGATACGACGAGGTGAAGAACATGATGTATACTCACGCCTTGGTCTGAGAGAGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210297] SGN-U573736 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30645 [Download] [View] Facility Assigned ID: TCAFH19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5