Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C64085

Search information 
Request: 64085Match: SGN-C64085
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64085Clone name: cLEM-5-B16
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177826 is on microarray TOM1: SGN-S1-1-1.1.6.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271309Length: 492 bp (618 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271309 [] (trimmed) CCTCGTAAAACTCCGATCACTTTCTGCAATCGCCGTCGATCTCCGTTGCGTAATCACACCGAACAATGTTTCGACACGGTTCTCGATTCCTAGCC
AGAGCCACCACGATGACGTGGCGCCGTCCATTTGCAACCGACCTGCAGGCGGAGTACGTTGCAGATTCCAGCTTTGCGGAAGCTTGGAAGAAAGT
TGTTCCTAATGTGGACCCACCGAAAACTCCATCTGCGTTTATGTCTCCTAGACCGGCTACTCCATCGTCGATTCCGTCTAAGCTCACTGTCAACT
TTGTCCTTCCTTACACTTCTGAACTCTCTGGTAAAGAGGTTGACATGGTTATAATCCCTGCAACAACAGGACAGATGGGTGTTTTACCTGGGCAT
GTAGCGACAATTGCTGAGCTGAAGCCTGGTATTTTATCAGTTCACGAGGGCAATGATGTGAACAAGTACTTTGTGAGTGGTGGATTTGCATTTGT
TCATGCAAATTCTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271309] SGN-U580868 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85114 [Download] [View] Facility Assigned ID: TGFAT08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5