EST details — SGN-C64106

Search information 
Request: 64106Match: SGN-C64106
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64106Clone name: cLEM-5-C17
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177839 is on microarray TOM1: SGN-S1-1-4.2.6.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177839 [TUS-27-J13] Trace: SGN-T183090 EST: SGN-E370853 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271175Length: 455 bp (1031 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271175 [] (trimmed) GGTTGGATATACAAGAATGAATTGGAGCAACAATCTAGTTCTTGCCCAATTTTACCTGATCCTAGCTACGTGAGGGACTATGACATAGCTTTGCA
GCTGCCTGAACTGAAGAAAATGCTTCAGGTTTTGAGGGAGAAGAGAGAAGGGGAAGGAGGGTGTGATAGAAAAGGGCCTGGGAATGTGTTCTTGG
TGGGTACTGGACCAGGTGATCCTGAGTTGTTGACTGTTAAGGCTTTGAGAGTTATTCAGAATGCTGATCTTTTGTTGTATGATAGATTGGTTTCT
AATGAAGTCTTGGATTTGGTTGGTCCTGATGCTAGGCTTCTCTATGTTGGTAAAACTGCTGGTTATCATAGCAGAACTCAGGAAGAAATTCATGA
GTTGCTTCTGAGTTTTGCTGAAGCTGGGGCCAATGTTGTGAGACTAAAAGGAGGTGACCCATTGGTATTTGGACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271175] SGN-U572308 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84980 [Download] [View] Facility Assigned ID: TGFAQ21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5