EST details — SGN-C64155

Search information 
Request: 64155Match: SGN-C64155
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64155Clone name: cLEM-5-E23
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177864 is on microarray TOM1: SGN-S1-1-3.3.6.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177864 [TUS-27-K14] Trace: SGN-T182956 EST: SGN-E370581 Direction: 3' Facility: INRA
Clone: SGN-C177864 [TUS-27-K14] Trace: SGN-T182957 EST: SGN-E370582 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271350Length: 430 bp (1014 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271350 [] (trimmed) GCTTTGGTGGAGGCGGGTTTGGTGGTGGTGGAAGCAGCAGAGGAAGAAGGCAAAGGAGAGGGGAGGATGTTGTCCACCCTCTCAAGGTCTCTTTG
GAGGATCTTTACAATGGAATATCAAAGAAGCTATCACTATCTCGCAATGTGTTGTGCTCAAAGTGCAAGGGGGTAGGGTCTAAATCAGGTGCTTC
ATTGAAATGTCCTGGATGTCAAGGGAAAGGAATGAAAGTTTCAATCAGACAACTTGGCCCCATGATCCAGCAGATGCAGCACCCATGTAATGAGT
GTAGGGGTACTGGTGAGAAAATAAACGATAAAGACAGGTGTCCACAGTGCAAGGGCGAGAAAGTTGTGCAGGAGAAGAAGGTGTTGGAAGTTGTT
GTGGATAAGGGTATGCAAAATGGACAAAAGATAACATTTCCAGGAGAGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271350] SGN-U579998 Tomato 200607 Build 2 94 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85155 [Download] [View] Facility Assigned ID: TGFAQ36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5