EST details — SGN-C64214

Search information 
Request: 64214Match: SGN-C64214
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64214Clone name: cLEM-5-H21
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177897 is on microarray TOM1: SGN-S1-1-2.4.6.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177897 [TUS-27-L23] Trace: SGN-T183179 EST: SGN-E370942 Direction: 3' Facility: INRA
Clone: SGN-C177897 [TUS-27-L23] Trace: SGN-T183180 EST: SGN-E370943 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271281Length: 477 bp (1020 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271281 [] (trimmed) GGTTTGAGATCTTACTTCCACGATTTTCTGGAGATATGCTCCCAAAGACCGAAGTTGGGTCTGTTTTGGCTATTACTGATAGGCTTGATAGCATT
GCTGGCTTATTTGCTGCTGGCTGTCAGCCAAGCTCAAGTAATGATCCATTTGGCCTGCGACGGATCTCCTACGGTCTTGTGCAACTCTTGGTTGA
AATTGACAGAAATGTGGACTTACGACAGGCTTTAGAACTTGCTGCTGCAGTGCAACCCATTGAAGTTGATGTCAGTACAATCAATGATGTACATC
AATTTGTAACACGCAGACTATAACAATTTCTGATGGACAAAGGTATAAGCCCAGAAGTCGTTAGGTCTGTTCTTTCCGAGCGTGCAAGACGACCT
GGTTTGGCGACTAAGTCAGTGTACAAAATGGAGTCCTTGTCCAAAGGGGAGCTTTTGCCTAAGGTTGTTGAAGCATATTCACGTCCAACAAGAAT
TG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271281] SGN-U585447 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85086 [Download] [View] Facility Assigned ID: TGFAS47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5